Data Loading...
STE-Biotech-Q3M1-MPNHS Flipbook PDF
STE-Biotech-Q3M1-MPNHS
121 Views
4 Downloads
FLIP PDF 3.69MB
8 Biotechnology
Quarter 3-Module 1
Tools in Genetic Engineering
Science – Grade 8 Alternative Delivery Mode Quarter 3 – Module 1: Tools in Genetic Engineering First Edition, 2021
Republic Act 8293, section 176 states that: No copyright shall subsist in any work of the Government of the Philippines. However, prior approval of the government agency or office wherein the work is created shall be necessary for exploitation of such work for profit. Such agency or office may, among other things, impose as a condition the payment of royalties. Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names, trademarks, etc.) included in this module are owned by their respective copyright holders. Every effort has been exerted to locate and seek permission to use these materials from their respective copyright owners. The publisher and authors do not represent nor claim ownership over them. Published by the Department of Education- Region III Secretary: Leonor Magtolis Briones Undersecretary: Diosdado M. San Antonio Development Team of the Module Writer/Illustrator/Layout/Editor Edna A. Antonio Marlon I. Santiago Norma S. Cajigas Content Evaluator: Lucena S. Paguinto/ Ma. Marissa V. Facun Language Evaluator: Ma. Cecilia L. Santiago Layout Evaluator: Joan T. Buluran Management Team: Gregorio C. Quinto Rainelda M. Blanco Agnes R. Bernardo Marinella P. Garcia Sy Glenda S. Constantino Joannarie C. Garcia Printed in the Philippines by Department of Education--- Schools Division of Bulacan Office Address:
E-mail address:
Curriculum Implementation Division Learning Resource Management and Development System (LRMDS) Capitol Compound, Guinhawa St., City of Malolos, Bulacan [email protected]
8 BIOTECHNOLOGY Quarter 3 – Module 1
Tools in Genetic Engineering
Introductory Message This Self-Learning Module (SLM) is prepared so that you, dear learners, can continue your studies and learn while at home. Activities, questions, directions, exercises, and discussions are carefully stated for you to understand each lesson. Each SLM is composed of different parts. Each part shall guide you step-by-step as you discover and understand the lesson prepared for you. Pre-tests are provided to measure your prior knowledge on lessons in each SLM. This will tell you if you need to proceed on completing this module or if you need to ask your facilitator or your teacher’s assistance for better understanding of the lesson. At the end of each module, you need to answer the post-test to self-check your learning. Answer keys are provided for each activity and test. We trust that you will be honest in using these. In addition to the material in the main text, Notes to the Teachers are also provided to our facilitators and parents for strategies and reminders on how they can best help you on your home-based learning. Please use this module with care. Do not put unnecessary marks on any part of this SLM. Use a separate sheet of paper in answering the exercise and tests. Read the instructions carefully before performing each task. If you have any questions in using this SLM or any difficulty in answering the tasks in this module, do not hesitate to consult your teacher orfacilitator. Thank you.
What I Need to Know This module provides varied activities that will help you describe the tools in genetic engineering. To enrich your knowledge and understanding about the lesson, there are examples and illustrations presented in this module. The examples and illustrations have been carefully chosen as a guide for you. There is a good combination of easy and challenging exercises and activities that enhance and develop your critical thinking skills. At the end of this module, you are expected to:
name the different tools in genetic engineering (PCR, Thermal cycler, Centrifuge, Transilluminator, and Restriction enzymes);
describe the function of each tool used in genetic engineering, and
identify the different restriction enzymes used in genetic engineering and describe how they work.
What I Know Directions: Read each question carefully. Choose the letter of the best answer. Use CAPITAL letters in writing your answer on a separate sheet of paper. 1. What does PCR mean? A. Polymerase Chain Reaction B. Polymerase Chain Reliever
C. Polymerase Change Reaction D. Polymerize Chill Reaction
2. He discovered the PCR machine and its processes. A. Harry Millis C. Kary Mullis B. Harry Mullis D. Mullis Mullis 3. There are three stages in using the PCR, which is the correct sequence of these stages? A. Annealing, Denaturing, Extending C. Denaturing, Extending,Annealing B. Denaturing, Annealing, Extending D. Extending, Annealing, Denaturing 4. It is the part where DNA is cut. A. replication site B. restriction area
C. restriction point D. restriction site
5. How are restriction enzymes named? A. based on the eukaryotic cell where DNA is isolated from B. based on the location of cell where enzymes are isolated C. based on the number of restriction sites D. based on the prokaryotic organism they are isolated from 1
6. Which of the following is the correct name of the restriction enzymes isolated from Escherichia coli with this as recognition site: 5’-GAATTC-3’/3’-CTTAAG-5’? A. EcoLi C. EcoRI B. EcoRE D. EcoRS 7. Which of the following materials can set up a PCR? A. buffer C. primers B. DNA template to be copied D. Taq polymerase 8. Which of the following recognition sites is identified by Escherichiacoli? A. 5’-GAATTA-3’/3’-CTTAAA-5’ C. 5’-GAATTC-3’/3’-CTTAAG-5’ B. 5’-GAATTC-3’/3’-CTTAAA-5’ D. 5’-GAATTG-3’/3’-CTTAAG-5’ 9. Genetic engineers are using restriction enzymes to cut DNA into fragments; one of these is the Taql. How does Taql cut the DNA if the recognition site is 5-’TCGA 3’/ 3’-AGCT-5’? A. 5’-CAAGGTCGACCACC-3’ 3’- GTTCCAGCTGGTGG-5’
C. 5’-CAAGGACGACCGACC-3’ 3’- GTTCCTGCTGGCTGG-5’
B. 5’-CAAGGACGACCGAC-3’ 3’- GTTCCTGCTGGCTG-5’
D. 5’-CAAGGTCGACCGACC-3’ 3’-GTTCCAGCTGGCTGG-5’
10. Which of the following refers to the heating and cooling processes carried out by the PCR machine? A. Thermal cycling C. Thermal recycling B. Thermal energy D. Thermal status 11. Which of the following describes annealing process? A. It uses primer and has the lowest needed temperature for thesample. B. It uses Taq polymerase. C. It uses the highest needed temperature for thesample. D. It uses the medium needed temperature for thesample. 12. Which of the following images represents the PCR machine?
A.
B.
C.
D.
13. Which of the following laboratory apparatuses is used to amplify segments of DNA via the PCR? A. Centrifuge C. Transilluminator B. Thermal cycler D. Scanner
2
14. Which of the following would bepalindromic? A. 5’-GAATTC-3’ C. 5’-CGAATT-3’ 3’-CTTAAG-5’ 3’-AATTCC-5’ B. 5’-GTTAAC-3’ D. 5’-GAATTT-3’ 3’-GAATTG-5’ 3’-AAATTG-5’ 15. The other term used for genetic engineering is _________________________. A. Bio Technology C. Recombinant RNA B. Recombinant DNA Technology D. RNA Recombinant Technology
What’s In Directions: GMO or Genetically Modified Organisms undergo mutations. Based on the ideas from the last module all about mutations match Column A with column B. Write the letter of your choice on a separate sheet of paper. Column A
Column B
1. Polyploidy
a. It is a process or occurrence where chromosomes failed to separate resulting in having extra chromosomes in the gametes.
2. Down’s syndrome
b. A monosomy syndrome having 44XO karyotype.
3. Turner’s syndrome
c. An abnormality found in chromosome number 21.
4. Non-disjunction
d. It involves the changes in the genetic materials of an organism.
5. Mutation
e. A condition of having more than 2 sets of chromosomes (3N, 4N, 6N, 8N). f. An abnormality found in chromosome number 18.
3
What’s New Let us start this Lesson 1 by having this song in the tune of Jingle Bells! PCR, PCR, PCR can play, As a tool to multiply segments of DNA, Hey! PCR, PCR, PCR can play Oh what else are its uses Let’s find out in this way… Hey! (2X) Based from the song, do you have an idea of what a PCR is? And how does it work? Write your answer inside the box.
What is It Since olden times the products such as wine, bread, and vinegar were so useful to man. These were beneficial products resulted from the process called fermentation. What comes to your mind when you hear the term fermented rice, fruits, and vegetables? Fermentation is the process by which microorganisms break down sugar without the use of oxygen. This process is considered as traditional method of biotechnology. Biotechnology is the science of life plus the varied techniques and ways (technologyfrom the two Greek words “techne” means art, way and “logos” - study ) to make products that are beneficial to man. There are two core techniques responsible for the birth of modern biotechnology. Indeed the significant contributions of Genetic engineering and the provision of Maintenance of a contamination - free environment to ensure the production or manufacturing of products such as antibiotics and vaccines is only done by the desired microbes. Genetic engineering involves techniques that change the chemistry of the genetic materials such as that when they reintroduced into the host, the host phenotype or physical appearance changes. It is also known as Recombinant DNA Technology. According to history, transgenesis was the first genetic modification done artificially using biotechnology. Transgenesis, the method used by which genes are transferred from one organism to another, credited to Herbert Boyer and Stanley Cohen in 1973 who conducted the first transgenesis process. The processes and techniques of genetic engineering can be made to happen by having different tools. What are these tools of genetic engineering?
4
LESSON 1: PCR Concepts Polymerase Chain Reaction (PCR) is a process used to great extent to rapidly make millions to billions of copies of a specific DNA (Deoxyribonucleic Acid) sample, helping scientists to get a very small sample of DNA and from this a large tremendous amount can be used in varied studies and researches. It is also called “molecular photocopying,” - a fast and inexpensive technique used to “amplify”- “increase” the copy of small segments of DNA. It is called “polymerase” because the only enzyme used in this reaction is DNA polymerase and “chains” because products of the first reaction become the substances of the following one and so on. For molecular and genetic analyses it’s absolutely impossible to study isolated pieces of DNA without PCR amplification and so without any question PCR is a miracle! Often championed as one of the most magnificent scientific advances in molecular biology, PCR fundamentally developed the course of DNA to such an extent that its creator, Kary B. Mullis, who invented it in 1983, patented it in 1985 and was awarded the Nobel Prize for Chemistry in 1993. PCR imitates what happens in cells- the basic units of life when DNA is copied (replicated) prior to cell division, but it is carried out in controlled conditions in a laboratory. The test tubes containing the DNA mixture of interest are put into the PCR machine, and the machine changes the temperature to suit each step of the process. Standard ingredients in the mixture are: *the DNA Template *specific primers *heat –resistant DNA polymerase enzyme/ Taq polymerase *the four different types of DNA nucleotides Deoxy nucleoside triphosphates *buffer solutions *the salts (Mg2+) needed to create a suitable environment for the enzyme to act. HOW DOES A PCR WORK? Step 1. Denaturation This is the process that requires a very high temperature for about 94 degrees Celsius (94⁰C) where the sample is heated so the DNA denatures meaning it separates into pieces of single- stranded DNA. The applied temperature to the mixture causes the breaking of hydrogen bonds between the complementary DNA strands. This process is called denaturation. Step 2. Annealing The second procedure needs specific primeers to bind to the target DNA sequences and starts polymerixation. For this process to achieve its product the temperature must be lowered to 54 degrees Celcius (54⁰C). One primer binds to each strand.
5
Step 3. Extension/Elongation The original strands serve as templates of the new strands of DNA to be produced. A DNA polymerase enzyme serves as binding substance for free DNA nucleotides to come together. DNA polymerase is often called Taq polymerase, an enzyme originally isolated from a thermophilic bacterium called Thermus aquaticus. It is from the sequence of the nucleotides in the original (template) DNA strand that the order in which free nucleotides to be added is determined. The required temperature for this step is 72 degrees Celsius (72⁰C). Two double-stranded sequences of target DNA are made as a result of one cycle of PCR. One containing newly made strand and the one is the same as of the original strand. Large quantities of DNA can be produced through the repetitions of the cycle which takes only 2-3 hours to get million to billion copies.
POLYMERASE CHAIN REACTION (PCR)
Genomic DNA C Y C L E 1
5’
3’
3’
5
DENATURATION
ANNEALING
Heat briefly to separate DNA strands
Cool to allow primers to form hydrogen bond with ends of the target sequence
primers
YIELDS 2 DNA MOLECULES
EXTENSION
Target sequence
New nucleotides
DNA polymerase adds nucleotides to the 3’ end of each primer
After cycle 2, yields 4 DNA molecules
Figure 1. Schematic Steps of How PCR works
6
APPLICATIONS OF PCR PCR (Polymerase Chain Reaction) has a great impact on the essential techniques in cellular and molecular biology. The “acellular cloning” of a DNA fragment through an automated system can be permitted for few hours because of the process which usually takes several days with standard techniques of molecular cloning. PCR is also widely used for diagnostic purposes (COVID-19 test). It can detect the presence of a specific DNA sequence of this or that organism in a biological fluid. Another breakthrough of PRC evolution is the genetic fingerprints, used in the genetic identification of a person in the discourse of a judicial inquest, or in establishing identity among animal and plant varieties, or the effects of microbes in food quality testing, diagnostics, or characterizing variations and selections. PCR is also highly recommended in the studies of site-directed mutagenesis and DNA sequencing procedure. VARIANTS OF PCR The all-around ability of polymerase chain reaction (PCR) has paved the way in the development of numerous variants of PCR. Some of them are listed below and figure 2 shows an illustration of one of these.
Real - time PCR
Competitive PCR PCR insitu
RT-PCR(Reverse Transcriptase-PCR)
Figure 2. Real- time PCR
FACT
Why RT- PCR is called the gold standard in diagnostic testing? • It is of highest quality, or benchmark. • It is also rapid. • High level of sensitivity. Note: Readings of why PCR is the gold standard for COVID-19 testing visit www.thermofisher.com
7
LESSON 2: Tools Used in PCR
The PCR works in its process through the help of other equipment such as thermal cycler, centrifuge, and transilluminator. What are the roles of these equipment let us find out ! Thermal Cycler – is also known as the PCR machine, a laboratory apparatus most commonly used “to amplify” - meaning to increase segments of DNA by the polymerase chain reaction. The apparatus can also facilitate sensitive reactions that required a high and low temperature such as restriction enzyme digestion and rapid results of diagnosis.
Figure 3. Thermal Cycler Centrifuge – is an instrument that can separate component parts of a liquid or fluid by using centrifugal force that will help in spinning the fluid at high speed within a container. The liquids separated from the solids or can be the separation of fluids of different densities.
Figure 4. Centrifuge Transilluminator – a highly delicate piece of equipment which works through the emission of high levels of ultraviolet radiations. It is used in life laboratories for the process of interpreting in visual terms the target DNAs and proteins through the viewing surface.
Figure 5. Transilluminator 8
DNA THERMAL CYCLER USE ‘STEP CYCLE PROGRAMME Heating and cooling processes occur in the DNA Thermal cycler and it is known as thermal cycling. The figure below shows the changes in the temperature as the sample is being processed and amplified.
Figure 6. Schematic role of Thermal Cycler in PCR
9
LESSON 3: Restriction Enzymes as a Tool (Concepts and Process) This is because DNA technologies are used in a range of industries; your body and your food are made of cells with DNA and proteins, it is indeed the wonderful work of genetic engineering through the help of another tool called restriction enzymes. What are enzymes? Enzymes are biological catalysts-found in all cells. They are molecules (usually proteins) that speed up chemical reactions. They work critically for a range of cellular processes including digestions, DNA replication, and protein synthesis. How about the so called restriction enzymes what is its role and how does it assist the many processes in laboratories around the world. Restriction endonucleases (RE) a.k.a. Restriction enzymes are termed as “molecular scissor”. Why “molecular scissors”? Just like the scissors that we are familiar to, the restriction enzymes have the ability to recognize specific base-pair sequences in DNA, and then cut the double-stranded DNA at those sites. These enzymes were discovered in bacteria. And help the bacteria destroy viral DNA.
Figure 7.” Molecular Scissors”
Figure 8. Restriction enzymes destroy viral DNA
Researchers rely on restriction enzymes in 1.) making recombinant DNA and appraising success, for research, medicine and agriculture 2.) DNA profile analysis used in disease diagnosis, paternity/family relationship testing, and forensics 3.) used in gene cloning, and 4.) protein expression experiments. To further understand restriction enzymes, let us define some terms associated with restriction enzymes: a. Recognition site- the sequence recognized by the enzyme. It is specific to each different RE (there are over 2500). It is about 4-8 bp (base pairs) in length and usually palindromic (e.g. MADAM I’M ADAM)
5’ –GAATTC- 3’ 3’ –CTTAAG- 5’
Figure 9. Recognition Site of Restriction enzyme EcoRI 10
b. Sticky ends- cleavage produces an overhang. It depends on where the RE cuts, it can be a 5’ or a 3’ overhang. c. Blunt ends- no overhang.
It depends on where the RE cuts, it can be a 5’ or a 3’ overhang
Figure 10. Sticky ends and Blunt ends Additional names of restriction enzymes, microorganisms where they are isolated and their restriction sites are given in the table below.
Table 1. List of Restriction Enzymes and Their Respective Recognition Sites
Source: https://slideplayer.com/slide/4568316/
11
HOW TO NAME RESRICTION ENZYMES Do you have any idea how RE’s got their names? Each restriction enzyme uses the name of the bacterium by which it is hidden or isolated. The naming system (nomenclature) is based on bacterial genus, species and strain. Here are some examples of how restriction enzymes are named, study and analyze how! Hindlll
EcoRI
BamHl
Genus
Escherichia
Haemophilus
Bacillus
Species
coli
influenza
amylo.
Strain
d
H
Order Isolated
R I
III
I
HOW RESTRICTION ENZYMES WORK? Restriction enzymes look for exact sequences of a defined length. Some enzymes recognize sequences 4 base pair (bp) - long for example GTAC, some 6 - GAATTC, and still others 8 or more. Special feature of most enzyme recognition sites is that they are palindromes. A palindrome has the exact order of bases which is read the same on both strands in the 5’ 3’ direction.
5’…GAATTC…3’ 3’…CTTAAG…5’ The above order of sequence is the recognition site for EcoRI or Escherichia coli strain R and order of isolation is I meaning- first. Observe how the sequence is written and read in the same from either direction? The arrows show the points at which the enzyme actually causes breaks or cuts in the backbone of the DNA. The hydrogen bonds are weakened and are not sufficient to hold the strands together, making the strands to separate due to the broken backbone of the DNA. A staggered cut produce single stranded “sticky ends”. 5’…GAATTC…3’ EcoRI 3’…CTTAAG …5’
5’…G 3’…CTTAA
12
AATTC…3’ G…5’
Sticky ends
Enzymes can also make fragments without single stranded ends as viewed from the given example, the double stranded DNA are separated equally on both strands producing the blunt ends.
5’…GATATC…3’ 3’…CTATAG…5’
EcoRV
5’…GAT
ATC…3’
3’…CTA
TAG…5’
Blunt ends
Sticky ends are more useful than the blunt ends! Why? It is because DNA fragments with complimentary sticky ends can combined to create new molecules of DNA. It is called Recombinant DNA (rDNA) which is widely used today in creating sequences helpful in studying genomes of different organisms.
FACTS: There are 3,000 RE’s, recognizing over 230 different DNA sequences and more than 600 of these are commercially available.
Lessons 1, 2 and 3 are truly significant in today’s situation wherein we often heard the words PCR test, RT-PCR and even the other tools that are indeed very useful in testing samples to address the COVID-19 pandemic.
13
What’s More Independent Activity 1 a-MAZE –me !
Directions: Play the Maze Game and try to escape then, find its end by following the clues found in each number, be careful and keep on the right track. Write the correct number maze track and the steps on how a PCR machine works on a separate sheet. Good luck!
PCR STARTS
1 Annealing 10Yields 4 2.Denaturation
11Yields 7 Denaturation 12 Yields 8 6 Extending
4 Annealing 5 Denaturation 3 Extending
9 Annealing 8
Extending
END
Choose the correct number maze track below… a.1,5,7,10,11
b. 1,6,7,9,12
c. 2,3,9,11,12
d. 2,4,8,11,12
Independent Assessment 1 Im-PRESS- me! Directions: Arrange the scrambled letters and form the term being described. Use the meaning as clues. Write your answers on a separate sheet of paper. 1. SEERALYPOM- the enzyme used in the reaction forPCR. 2. TRIGEFUNEC- is a device that uses centrifugal force to separate components parts of a liquid or fluid. 3. XYOBODECILECIRUN DICA – a nucleotide characterized as double stranded molecule. 4. REATMHL CCRYEL- is a laboratory apparatus most commonly used to amplify segments of DNA via the polymerase chainreaction. 14
5. EEIGNDTXN- where DNA polymerase enzyme joins free DNA nucleotides together. _6. LLARTRSTOAMIINNAU- is a standard piece of equipment used in life laboratories for visualization of target DNAs and proteins. 7. TUNARANOTIDE- sample is heated at 92 degrees Celsius. 8. NENALINGA- primers bind to the target DNA sequences and initiate polymerization. 9. RUSMETH AASUCITQU- a bacterium which Taq polymerase enzymeis obtained. 10. RAKY SMLLUI- creator of Polymerase Chain Reaction.
Independent Activity 2 Im-PRINT me! Directions: Using the image below and the notations, reproduce DNA molecules keeping in mind the steps of how thermal cycler in PCR works. Write the total number of DNA molecules at the end of every cycle.. Are you ready? Write your answers on a separate sheet of paper. For every step cycle, the DNA molecule is doubled, so after n cycles you have 2^- it means 2 raise to the n:th power, copies of DNA. For example, 2¹ = 2 , it means that 1 DNA molecule after the first cycle yields 2 molecules of DNA. 2² = 4 , it means that 2 DNA molecules raise to 2 became 4 after the second cycle… so on and so forth… n:th power or exponent (tells how many times a number is multiplied by itself or it refers also to the number of PCR cycles)
1. 2
2. 4
3._____ 4._____5.______ 6.______7.______ 8.______9.______10.______
15
Independent Assessment 2 as-SORT me!
Directions: Group the following processes or events as to Denaturation, Annealing, and Extending. Write them on the appropriate box. Write your answers on a separate sheet of paper. Denaturation
Annealing
Extending
1. The temperature of the solution has been lowered to 54 degreesCelsius. 2. The sample is first heated making the DNA separates into pieces of single- stranded DNA. 3. The separation happens by raising the temperature of the mixture. 4. A DNA polymerase enzyme joins free DNA nucleotides together. 5. Primers bind to the target DNA sequences and initiate polymerization. 6. The result of one cycle of PCR is two double-stranded sequences of target DNA, each containing one newly made strand and one original strand.
Independent Activity 3 In- STRUCK me!
Directions: Using Table 1 List of Restriction enzymes as reference cut the DNA to its recognition sites and answer the guide questions. Write your answers on a separate sheet of paper. 1. 5’- AATTCGCCCGGGATATTACGCCCGGGATTAGCATTATCCGCCCGGGATATTTTAGCA-3’ 3’- TTAAGCGGGCCCTATAATGCGGGCCCTAATCGTAATAGGCGGGCCCTATAAAATCGT-5’
Smal recognition site: 5’-CCCGGG-3’ 3’-GGGCCC-5’ Cut between the C and G What type of ends will the produced fragments have? 2. 5’-CGATTCAAGCTTGGATTAAGCTTGGCCTTAAGCTTACCCGGGATTA -3’ 3’-GCTAAGTTCGAACCTAATTCGAACCGGAATTCGAATGGGCCCTAAT -5’
HindIII recognition site: 5’- AAGCTT-3’ 3’- TTCGAA-5’ Cut between 2 A What type of ends will the produced fragments have? 16
Independent Assessment 3 Re- CALL me! Directions: Give the name of the restriction enzyme based from its genus, species, strain and order of isolation. Write your answers on a separate sheet of paper. (Note: The genus and species name must be italicized). Genus
Species
1.
Escherichia
coli
2.
Streptomyces
albus
3.
Bacillus
amylo.
4.
Serratia
mercescens
5.
Haemophilus
parainfluenzae
Strain
Order of Isolation
R
I I
H
I I d
III
What I Have Learned BUILDING TAXONOMY Directions: Write down a word or words for each letter of the alphabet that is related to the subject theme: TOOLS in GENETIC ENGINEERING! Write your answers on a separate sheet of paper. You can start with… Mr. Webster can help… Doc Google too… A- Annealing
G
M
S
Y-Yields
B- Blunt ends
H
N
T
Z- Zymase
C
I
O
U
D
J
P
V
E
K
Q- Q fever
W
F
L
R
X- X-radiation
17
What I Can Do Directions: Fill up the graphic organizer about the uses of PCR (Polymerase Chain Reaction) and RE (Restriction Enzymes) below and write two statements about the importance of these tools in genetic engineering. Write your answers on a separate sheet of paper.
Assessment Directions: Read and understand each question and select the letter of the best answer. Write your answers on a separate sheet of paper. 1.
Which of the following processes in PCR needs the highesttemperature? a. Annealing c. Extending b. Denaturation d. None of these
2.
How many restriction enzymes are available commercially? a. 1000 c. 500 b. 120 d. 600
3.
It refers to the sequence of DNA where restriction enzyme cuts orcleaves. a. Replication area c. Restriction site b. Replication site d. Restriction website
4. Which of the following statements best describes a palindrome?
a. It has reversible N-bases. b. It has irreversible N-bases. c. It has an exact order of bases which is read the same on both strands in the 5’ 3’ direction d. It has an exact order of sugar which is read the same on both strands in the 5’ 3’ direction
5. How many DNA molecules are produced from 1 DNA molecule after the10thcycle
using the PCR machine? a. 100 b. 1000
c. 1084 d. 1024 18
6.
Which of the following is the required temperature for annealing process to happen? a. 54 degrees Celsius c. 74 degrees Celsius b. 64 degrees Celsius d. 94 degrees Celsius
7. What type of end is shown by the given example 5’…G
3’…CTTAA G…5’? a. Blunt ends b. Blonde ends
AATTC…3’
c. Sticky ends d. Tricky ends
8. It is a laboratory apparatus most commonly used to amplify segments of DNA via
the polymerase chain reaction. a. Centrifuge b. Microtubes
c. Thermal cycler d. Transilluminator
9. Which of the following restriction enzymes refers to Haemophilus parainfluenzae (recognition site: 5’-AAGCTT-3’/3’-TTCGAA-5’) a. HindI c. Hindlll b. Hindll d. Hindlll 10. There are three stages in using the PCR, which is the NOT included?
a. Annealing b. Denaturation
c. Deterioration d. Extending
11. Which of the following recognition sites is identified by restriction enzyme AluI? a. 5’-AGCT-3’ c. 5’-GAAT-3’ 3’-TCGA-5’ 3’ CTTA -5’ b. 5-’GAAT-3’ d. 5’- AGTT-3’ 3’-CTTA-5’ 3’-TCAA- 5’ 12. Why RT-PCR is called the gold standard in diagnostictesting? a. It is very expensive c. It is very sensitive
b. It is very slow
d. All of the above
13. Which of the following is a NOT a variant of PCR? a. Competition PCR c. Real-time PCR b. PCR insitu d. Reverse Transcriptase PCR 14. Why is RE called molecular scissors? a. It cuts a DNA sequence. b. It cuts a specific DNA sequence.
c. It cuts anywhere in a DNA molecule. d. It cuts the DNA to produce RNA.
15. The enzymes responsible for the PCR machine towork. a. Escherichia enzymes c. Restriction enzymes b. Polymerase d. Thermus enzymes
19
Additional Activities After describing and explaining the concepts of the different tools in Genetic engineering this time you need to answer and perform the G.R.A.S.P.S. It is a performance task scenario that will focus on the lessons that you have learned. Write your answers on a separate sheet of paper. G (Goal): The goal is to
My task is
R (Role) My job/I am A (Audience) My target audience S (Situation) The challenge involves dealing with P (Product/Performance) I will create a
in order to
I need to develop
so that
_
S (Standards) My product/performance must meet the following standards Your work will be graded using the RUBRIC below. Criteria
Excellent 4 The output shows all (4) the tools used in genetic engineering and able to describe each tool correctly.
Good 3 The output shows only half of the tools used in genetic engineering and able to describe each tool correctly.
Fair 2 The output shows only one of the tools used in genetic engineering and able to describe it correctly.
Developing 1 The output shows not even one tool used in genetic engineering.
Originality
Presentation of the output is original, creative and 100 percent unique.
Presentation of the output is original, creative and 80 percent unique.
Presentation of the output is original, creative and 60 percent unique.
Presentation of the output is not original and copied only from the internet.
Over-all impact
Layout and design are attractive and correct.
Layout and design are attractive and but not correct.
Layout and design are attractive only.
No layout and design.
Content
20
21
22
References A. Books Mullis, K. (1990). The unusual origin of the polymerase chain reaction. Scientific American April 56-65 Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., and Erlich, H. (1985). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350-54 Rabinow, P. (1996). Making PCR: A story of biotechnology. University of Chicago Press B. Electronic Sources Biotechnology Accessed December 10, 2020, www.thermofisher.com www.slideserve.com>moriah>biotechnology PPT-BIOTECHNOLOGICAL TOOLS & TECHNIQUES-Power point Accessed January 10, 2021, quora.com-How do bacterial restriction enzymes cut down viral DNA but do not harm to the bacterial chromosomes? 10 Tools used in Genetic Engineering Accessed January 18, 2021, explorebiotech.com Restriction Enzymes, Accessed January 24, 2021, www.promega.com>guides> restriction enzymes Slideshare.net Restriction endonucleases-Mohammad Anas Published on March 28, 2017 www.iitk.ac.in> dordold Thermal Cycler Accessed January 27, 2021, en.m.wikipedia.org>wiki>Thermal Cycler
23
For inquiries or feedback, please write: Department of Education, Schools Division of Bulacan Curriculum Implementation Division Learning Resource Management and Development System (LRMDS) Capitol Compound, Guinhawa St., City of Malolos, Bulacan Email Address:[email protected]